Antibodies
Anti-Wnt5a Antibody-Oligo Conjugate
SKU: aoc3817
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Wnt5a Antibody-IF1
Antibody Target
- Target
- Protein Wnt-5a
- UniProt Number
- P41221
- Target Description
- Ligand for members of the frizzled family of seven transmembrane receptors. Can activate or inhibit canonical Wnt signaling, depending on receptor context. In the presence of FZD4, activates beta-catenin signaling. In the presence of ROR2, inhibits the canonical Wnt pathway by promoting beta-catenin degradation through a GSK3-independent pathway which involves down-regulation of beta-catenin-induced reporter gene expression. Suppression of the canonical pathway allows chondrogenesis to occur and inhibits tumor formation. Stimulates cell migration. Decreases proliferation, migration, invasiveness and clonogenicity of carcinoma cells and may act as a tumor suppressor. Mediates motility of melanoma cells. Required during embryogenesis for extension of the primary anterior-posterior axis and for outgrowth of limbs and the genital tubercle. Inhibits type II collagen expression in chondrocytes.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0405
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human