Antibodies
Anti-WT1 Antibody-Oligo Conjugate
SKU: aoc3819
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-WT1 Antibody-IF1
Antibody Target
- Target
- Wilms tumor protein
- UniProt Number
- P19544
- Target Description
- Transcription factor that plays an important role in cellular development and cell survival. Recognizes and binds to the DNA sequence 5'-GCG(T/G)GGGCG-3'. Regulates the expression of numerous target genes, including EPO. Plays an essential role for development of the urogenital system. It has a tumor suppressor as well as an oncogenic role in tumor formation. Function may be isoform-specific: isoforms lacking the KTS motif may act as transcription factors. Isoforms containing the KTS motif may bind mRNA and play a role in mRNA metabolism or splicing. Isoform 1 has lower affinity for DNA, and can bind RNA.
- Molecular Weight
- 49kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2610
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat