Antibodies
Anti-WTAP Antibody-Oligo Conjugate
SKU: aoc3820
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-WTAP Antibody-IF1
Antibody Target
- Target
- Pre-mRNA-splicing regulator WTAP
- UniProt Number
- Q15007
- Target Description
- Associated component of the WMM complex, a complex that mediates N6-methyladenosine (m6A) methylation of RNAs, a modification that plays a role in the efficiency of mRNA splicing and RNA processing. Required for accumulation of METTL3 and METTL14 to nuclear speckle. Acts as a mRNA splicing regulator. Regulates G2/M cell-cycle transition by binding to the 3' UTR of CCNA2, which enhances its stability. Impairs WT1 DNA-binding ability and inhibits expression of WT1 target genes.
- Molecular Weight
- 44kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC56272
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat