Antibodies
Anti-Xanthine Oxidase (XDH) Antibody-Oligo Conjugate
SKU: aoc3821
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Xanthine Oxidase (XDH) Antibody-IF1
Antibody Target
- Target
- Xanthine dehydrogenase/oxidase [Includes: Xanthine dehydrogenase
- UniProt Number
- P47989
- Target Description
- Key enzyme in purine degradation. Catalyzes the oxidation of hypoxanthine to xanthine. Catalyzes the oxidation of xanthine to uric acid. Contributes to the generation of reactive oxygen species. Has also low oxidase activity towards aldehydes (in vitro).
- Molecular Weight
- 146kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC1385
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat