Antibodies
Anti-XPD Antibody-Oligo Conjugate
SKU: aoc3824
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-XPD Antibody-IF1
Antibody Target
- Target
- General transcription and DNA repair factor IIH helicase subunit XPD
- UniProt Number
- P18074
- Target Description
- ATP-dependent 5'-3' DNA helicase. Component of the general transcription and DNA repair factor IIH (TFIIH) core complex, not absolutely essential for minimal transcription in vitro. Required for transcription-coupled nucleotide excision repair (NER) of damaged DNA; recognizes damaged bases. Sequestered in chromatin on UV-damaged DNA. When complexed to CDK-activating kinase (CAK), involved in transcription by RNA polymerase II. In NER, TFIIH acts by opening DNA around the lesion to allow the excision of the damaged oligonucleotide and its replacement by a new DNA fragment. The ATP-dependent helicase activity of XPD/ERCC2 is required for DNA opening. Involved in DNA lesion verification. In transcription, TFIIH has an essential role in transcription initiation. When the pre-initiation complex (PIC) has been established, TFIIH is required for promoter opening and promoter escape. Phosphorylation of the C-terminal tail (CTD) of the largest subunit of RNA polymerase II by the kinase module CAK controls the initiation of transcription. XPD/ERCC2 acts by forming a bridge between CAK and the core-TFIIH complex. The structure of the TFIIH transcription complex differs from the NER-TFIIH complex; large movements by XPD/ERCC2 and XPB/ERCC3 are stabilized by XPA which allow this subunit to contact ssDNA. Involved in the regulation of vitamin-D receptor activity. As part of the mitotic spindle-associated MMXD complex it plays a role in chromosome segregation. Might have a role in aging process and could play a causative role in the generation of skin cancers.
- Molecular Weight
- 87kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2401
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat