Antibodies
Anti-XPNPEP3 Antibody-Oligo Conjugate
SKU: aoc3825
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-XPNPEP3 Antibody-IF1
Antibody Target
- Target
- Xaa-Pro aminopeptidase 3
- UniProt Number
- Q9NQH7
- Target Description
- Catalyzes the removal of a penultimate prolyl residue from the N-termini of peptides, such as Leu-Pro-Ala. Also shows low activity towards peptides with Ala or Ser at the P1 position.; FUNCTION: [Isoform 1]: Promotes TNFRSF1B-mediated phosphorylation of MAPK8/JNK1 and MAPK9/JNK2, suggesting a function as an adapter protein for TNFRSF1B; the effect is independent of XPNPEP3 peptidase activity. May inhibit apoptotic cell death induced via TNF-TNFRSF1B signaling.
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC70227
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat