Antibodies
Anti-YAP1 Antibody-Oligo Conjugate
SKU: aoc3828
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-YAP1 Antibody-IF1
Antibody Target
- Target
- Transcriptional coactivator YAP1
- UniProt Number
- P46937
- Target Description
- Transcriptional regulator with dual roles as a coactivator and corepressor. Critical downstream regulatory target in the Hippo signaling pathway, crucial for organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The Hippo signaling pathway core involves a kinase cascade featuring STK3/MST2 and STK4/MST1, along with its regulatory partner SAV1, which phosphorylates and activates LATS1/2 in complex with their regulatory protein, MOB1. This activation leads to the phosphorylation and inactivation of the YAP1 oncoprotein and WWTR1/TAZ. Phosphorylation of YAP1 by LATS1/2 prevents its nuclear translocation, thereby regulating the expression of its target genes. The transcriptional regulation of gene expression requires TEAD transcription factors and modulates cell growth, anchorage-independent growth, and induction of epithelial-mesenchymal transition (EMT). Plays a key role in tissue tension and 3D tissue shape by regulating the cortical actomyosin network, acting via ARHGAP18, a Rho GTPase activating protein that suppresses F-actin polymerization. It also suppresses ciliogenesis by acting as a transcriptional corepressor of TEAD4 target genes AURKA and PLK1. In conjunction with WWTR1, regulates TGFB1-dependent SMAD2 and SMAD3 nuclear accumulation. Synergizes with WBP2 to enhance PGR activity.; FUNCTION: [Isoform 2]: Activates the C-terminal fragment (CTF) of ERBB4 (isoform 3).; FUNCTION: [Isoform 3]: Activates the C-terminal fragment (CTF) of ERBB4 (isoform 3).
- Molecular Weight
- 54kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISAChIP
- Clone
- ARC53479
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat