Antibodies
Anti-YTHDC1 Antibody-Oligo Conjugate
SKU: aoc3834
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-YTHDC1 Antibody-IF1
Antibody Target
- Target
- YTH domain-containing protein 1
- UniProt Number
- Q96MU7
- Target Description
- Regulator of alternative splicing that specifically recognizes and binds N6-methyladenosine (m6A)-containing RNAs. M6A is a modification present at internal sites of mRNAs and some non-coding RNAs and plays a role in the efficiency of mRNA splicing, processing and stability. Acts as a key regulator of exon-inclusion or exon-skipping during alternative splicing via interaction with mRNA splicing factors SRSF3 and SRSF10. Specifically binds m6A-containing mRNAs and promotes recruitment of SRSF3 to its mRNA-binding elements adjacent to m6A sites, leading to exon-inclusion during alternative splicing. In contrast, interaction with SRSF3 prevents interaction with SRSF10, a splicing factor that promotes exon skipping: this prevents SRSF10 from binding to its mRNA-binding sites close to m6A-containing regions, leading to inhibit exon skipping during alternative splicing. May also regulate alternative splice site selection. Also involved in nuclear export of m6A-containing mRNAs via interaction with SRSF3: interaction with SRSF3 facilitates m6A-containing mRNA-binding to both SRSF3 and NXF1, promoting mRNA nuclear export. Involved in S-adenosyl-L-methionine homeostasis by regulating expression of MAT2A transcripts, probably by binding m6A-containing MAT2A mRNAs. Also recognizes and binds m6A on other RNA molecules. Involved in random X inactivation mediated by Xist RNA: recognizes and binds m6A-containing Xist and promotes transcription repression activity of Xist. Also recognizes and binds m6A-containing single-stranded DNA. Involved in germline development: required for spermatogonial development in males and oocyte growth and maturation in females, probably via its role in alternative splicing.
- Molecular Weight
- 85kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC59465
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat