Antibodies
Anti-YTHDF1 Antibody-Oligo Conjugate
SKU: aoc3835
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-YTHDF1 Antibody-PLA1
Antibody Target
- Target
- YTH domain-containing family protein 1
- UniProt Number
- Q9BYJ9
- Target Description
- Specifically recognizes and binds N6-methyladenosine (m6A)-containing mRNAs, and regulates their stability. M6A is a modification present at internal sites of mRNAs and some non-coding RNAs and plays a role in mRNA stability and processing. Acts as a regulator of mRNA stability by promoting degradation of m6A-containing mRNAs via interaction with the CCR4-NOT complex. The YTHDF paralogs (YTHDF1, YTHDF2 and YTHDF3) shares m6A-containing mRNAs targets and act redundantly to mediate mRNA degradation and cellular differentiation. Required to facilitate learning and memory formation in the hippocampus by binding to m6A-containing neuronal mRNAs. Acts as a regulator of axon guidance by binding to m6A-containing ROBO3 transcripts. Acts as a negative regulator of antigen cross-presentation in myeloid dendritic cells. In the context of tumorigenesis, negative regulation of antigen cross-presentation limits the anti-tumor response by reducing efficiency of tumor-antigen cross-presentation. Promotes formation of phase-separated membraneless compartments, such as P-bodies or stress granules, by undergoing liquid-liquid phase separation upon binding to mRNAs containing multiple m6A-modified residues: polymethylated mRNAs act as a multivalent scaffold for the binding of YTHDF proteins, juxtaposing their disordered regions and thereby leading to phase separation. The resulting mRNA-YTHDF complexes then partition into different endogenous phase-separated membraneless compartments, such as P-bodies, stress granules or neuronal RNA granules.
- Molecular Weight
- 20kDa/60kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC59730
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat