Antibodies
Anti-YY1 Antibody-Oligo Conjugate
SKU: aoc3836
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-YY1 Antibody-IF1
Antibody Target
- Target
- Transcriptional repressor protein YY1
- UniProt Number
- P25490
- Target Description
- Multifunctional transcription factor that exhibits positive and negative control on a large number of cellular and viral genes by binding to sites overlapping the transcription start site. Binds to the consensus sequence 5'-CCGCCATNTT-3'; some genes have been shown to contain a longer binding motif allowing enhanced binding; the initial CG dinucleotide can be methylated greatly reducing the binding affinity. The effect on transcription regulation is depending upon the context in which it binds and diverse mechanisms of action include direct activation or repression, indirect activation or repression via cofactor recruitment, or activation or repression by disruption of binding sites or conformational DNA changes. Its activity is regulated by transcription factors and cytoplasmic proteins that have been shown to abrogate or completely inhibit YY1-mediated activation or repression. For example, it acts as a repressor in absence of adenovirus E1A protein but as an activator in its presence. Acts synergistically with the SMAD1 and SMAD4 in bone morphogenetic protein (BMP)-mediated cardiac-specific gene expression. Binds to SMAD binding elements (SBEs) (5'-GTCT/AGAC-3') within BMP response element (BMPRE) of cardiac activating regions. May play an important role in development and differentiation. Proposed to recruit the PRC2/EED-EZH2 complex to target genes that are transcriptional repressed. Involved in DNA repair. In vitro, binds to DNA recombination intermediate structures (Holliday junctions). Plays a role in regulating enhancer activation. Recruits the PR-DUB complex to specific gene-regulatory regions.; FUNCTION: Proposed core component of the chromatin remodeling INO80 complex which is involved in transcriptional regulation, DNA replication and probably DNA repair; proposed to target the INO80 complex to YY1-responsive elements.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISAChIP
- Clone
- ARC0048
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat