Antibodies
Anti-ZBP1 Antibody-Oligo Conjugate
SKU: aoc3839
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ZBP1 Antibody-IF1
Antibody Target
- Target
- Z-DNA-binding protein 1
- UniProt Number
- Q9H171
- Target Description
- Key innate sensor that recognizes and binds Z-RNA structures, which are produced by a number of viruses, such as herpesvirus, orthomyxovirus or flavivirus, and triggers different forms of cell death. ZBP1 acts as an essential mediator of pyroptosis, necroptosis and apoptosis (PANoptosis), an integral part of host defense against pathogens, by activating RIPK3, caspase-8 (CASP8), and the NLRP3 inflammasome. Key activator of necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members, via its ability to bind Z-RNA: once activated upon Z-RNA-binding, ZBP1 interacts and stimulates RIPK3 kinase, which phosphorylates and activates MLKL, triggering execution of programmed necrosis. In addition to TNF-induced necroptosis, necroptosis can also take place in the nucleus in response to orthomyxoviruses infection: ZBP1 recognizes and binds Z-RNA structures that are produced in infected nuclei by orthomyxoviruses, such as the influenza A virus (IAV), leading to ZBP1 activation, RIPK3 stimulation and subsequent MLKL phosphorylation, triggering disruption of the nuclear envelope and leakage of cellular DNA into the cytosol. ZBP1-dependent cell death in response to IAV infection promotes interleukin-1 alpha (IL1A) induction in an NLRP3-inflammasome-independent manner: IL1A expression is required for the optimal interleukin-1 beta (IL1B) production, and together, these cytokines promote infiltration of inflammatory neutrophils to the lung, leading to the formation of neutrophil extracellular traps. In addition to its direct role in driving necroptosis via its ability to sense Z-RNAs, also involved in PANoptosis triggered in response to bacterial infection: component of the AIM2 PANoptosome complex, a multiprotein complex that triggers PANoptosis. Also acts as the apical sensor of fungal infection responsible for activating PANoptosis. Involved in CASP8-mediated cell death via its interaction with RIPK1 but independently of its ability to sense Z-RNAs. In some cell types, also able to restrict viral replication by promoting cell death-independent responses. In response to Zika virus infection in neurons, promotes a cell death-independent pathway that restricts viral replication: together with RIPK3, promotes a death-independent transcriptional program that modifies the cellular metabolism via up-regulation expression of the enzyme ACOD1/IRG1 and production of the metabolite itaconate. Itaconate inhibits the activity of succinate dehydrogenase, generating a metabolic state in neurons that suppresses replication of viral genomes.; FUNCTION: (Microbial infection) In case of herpes simplex virus 1/HHV-1 infection, forms hetero-amyloid structures with HHV-1 protein RIR1/ICP6 which may inhibit ZBP1-mediated necroptosis, thereby preventing host cell death pathway and allowing viral evasion.
- Molecular Weight
- 46kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC74866
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human