Antibodies

Anti-ZBTB7A Antibody-Oligo Conjugate

SKU: aoc3840

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-ZBTB7A Antibody-IF1

Antibody Target

Target
Zinc finger and BTB domain-containing protein 7A
UniProt Number
O95365
Target Description
Transcription factor that represses the transcription of a wide range of genes involved in cell proliferation and differentiation. Directly and specifically binds to the consensus sequence 5'-[GA][CA]GACCCCCCCCC-3' and represses transcription both by regulating the organization of chromatin and through the direct recruitment of transcription factors to gene regulatory regions. Negatively regulates SMAD4 transcriptional activity in the TGF-beta signaling pathway through these two mechanisms. That is, recruits the chromatin regulator HDAC1 to the SMAD4-DNA complex and in parallel prevents the recruitment of the transcriptional activators CREBBP and EP300. Collaborates with transcription factors like RELA to modify the accessibility of gene transcription regulatory regions to secondary transcription factors. Also directly interacts with transcription factors like SP1 to prevent their binding to DNA. Functions as an androgen receptor/AR transcriptional corepressor by recruiting NCOR1 and NCOR2 to the androgen response elements/ARE on target genes. Thereby, negatively regulates androgen receptor signaling and androgen-induced cell proliferation. Involved in the switch between fetal and adult globin expression during erythroid cells maturation. Through its interaction with the NuRD complex regulates chromatin at the fetal globin genes to repress their transcription. Specifically represses the transcription of the tumor suppressor ARF isoform from the CDKN2A gene. Efficiently abrogates E2F1-dependent CDKN2A transactivation. Regulates chondrogenesis through the transcriptional repression of specific genes via a mechanism that also requires histone deacetylation. Regulates cell proliferation through the transcriptional regulation of genes involved in glycolysis. Involved in adipogenesis through the regulation of genes involved in adipocyte differentiation. Plays a key role in the differentiation of lymphoid progenitors into B and T lineages. Promotes differentiation towards the B lineage by inhibiting the T-cell instructive Notch signaling pathway through the specific transcriptional repression of Notch downstream target genes. Also regulates osteoclast differentiation. May also play a role, independently of its transcriptional activity, in double-strand break repair via classical non-homologous end joining/cNHEJ. Recruited to double-strand break sites on damage DNA, interacts with the DNA-dependent protein kinase complex and directly regulates its stability and activity in DNA repair. May also modulate the splicing activity of KHDRBS1 toward BCL2L1 in a mechanism which is histone deacetylase-dependent and thereby negatively regulates the pro-apoptotic effect of KHDRBS1.
Molecular Weight
61kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCICCELISA
Clone
ARC2320
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human