Antibodies
Anti-ZNF143 Antibody-Oligo Conjugate
SKU: aoc3843
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ZNF143 Antibody-IF1
Antibody Target
- Target
- Zinc finger protein 143
- UniProt Number
- P52747
- Target Description
- Transcriptional activator. Activates the gene for selenocysteine tRNA (tRNAsec). Binds to the SPH motif of small nuclear RNA (snRNA) gene promoters. Participates in efficient U6 RNA polymerase III transcription via its interaction with CHD8. In complex with HCFC1 and ZNF143, regulates the expression of several genes, including AP2S1, ESCO2, OPHN1, RBL1, UBXN8 and ZNF32.
- Molecular Weight
- 69kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC62979
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat